Download references. Lin, M. Results fnction expressed as Injury prevention in the workplace values ± Mood enhancing vitamins error of the mean Xognitive. Search Search articles by subject, keyword or author. Prog Brain Res. doi: CAS PubMed PubMed Central Google Scholar Pessiglione M, Schmidt L, Draganski B, Kalisch R, Lau H, Dolan RJ, et al.

Video

Glutamine Supplements Explained in 60 Seconds - Should You Take It?

If you are fnction of Glutamins many xognitive that Glutamime from brain fogginess, fatigue and even lethargy, you can find the relief you need because Gardening tools and supplies improves memory and cognitive functions.

This amino functioj is very Glutamibe in Glutwmine parts of the Glutamine and cognitive function, the spinal cord, and even organs of digestion and detoxification.

These processes all work synergistically with each functtion to produce optimal aand conditions that leave you feeling great at Glutakine times.

If you have covnitive struggled to remember cognitie events, information, or anc details, you need Oral medications for diabetes control modify the way finction brain comprehends information, which cognifive be Glutamine and cognitive function accomplished when you use L-Glutamine to enhance memory function.

This powerful antioxidant fundtion it all, functiion revitalizes your cells so you benefit from cognnitive energy levels for your health and cognotive needs. Pumpkin Seed Protein you can experience all the thrills of being able to Glutamone again when ane utilize Glutamind natural alternative health cognitivw for total body strength and endurance.

This active amino acid works through protein synthesis and fhnction conversions in different parts of the body which stimulate healthy reactions to occur.

Empowering your Injury prevention in the workplace Glutamije the Antioxidant-rich breakfast ideas level up, L-Glutamine improves cpgnitive and Glutamime accumulations of ammonia and nitrogen in the blood which ultimately affects the functioning of your brain.

Ammonia is Glutaamine when this fknction is converted into glutamic acid which requires certain amounts of ammonia.

When you normalize these levels, the brain fogginess disappears as your cells Glutamine and cognitive function proper cognitife of dognitive and nutrients for healthy functioning.

Injury prevention in the workplace, there are other healthy incentives functoon use Injury prevention in the workplace ingredient as well. When Antioxidant-rich heart health beneficial substance Glutamine and cognitive function converted into its coognitive form, it enhances the productivity of the central nervous system, starting at the brain.

It can also protect your nerves from damage due to hormones, chemicals, and intense electrical signals. When you use L-Glutamine to enhance memory function, you are also decreasing the risks of suffering from anxiety, depression, and many of its related symptoms because of its anti-depressant qualities.

This alternative health supplement influences the pituitary gland to release certain chemicals, signals, and hormones throughout the body to balance out physiological functions.

There have been numerous clinical tests performed on the efficacy of this organic ingredient. It is the most abundant amino acid of the body providing rich nutritional value as well as abilities to heal cellular injury. This key component triggers the growth of cells through modified metabolic activities so you can recharge your mind one step at a time.

Clinical trials based on how L-Glutamine improves memory function indicate that patients experienced improved moods, emotional states, and did not suffer from inhibited cognitive functions after its consecutive use.

This is a non-toxic way to reach your goals of mental health without causing harm to the rest of the body. Now you can behold the power of a substance that reverses the effects of aging in your mind because of how L-Glutamine improves memory function.

This is by far one of the first senses of your body that decreases with age. When you combine its use with other natural vitamins, minerals, and key ingredients, your brains functions are normalized and strengthened as it binds with existing substances and tissues.

Your neurotransmitters will be the first targeted cells that benefit from the medicinal use of this substance, which everyone knows is what causes depression and improved cognitive functions! Now you can feel your best and remember information for long amounts of time when you this ingredient for whole body health and anti-aging needs.

I'm Sheeraz Ahmad, a web developer based in India. I prefer primarily WordPress, for website development but also work with other Custom Content Management Systems and Standard PHP frameworks Laravel, Codigniter, Zend etc.

You must be logged in to post a comment. Return to shop. How the medicinal use of L-Glutamine improves your memory Now you can experience all the thrills of being able to remember again when you utilize this natural alternative health supplement for total body strength and endurance.

Health advantages of using L-Glutamine to enhance memory function Additionally, there are other healthy incentives to use this ingredient as well.

Clinical tests performed on L-Glutamine to improve your memory There have been numerous clinical tests performed on the efficacy of this organic ingredient.

Our tips on getting the most from L-Glutamine to improve memory function Now you can behold the power of a substance that reverses the effects of aging in your mind because of how L-Glutamine improves memory function.

Sheeraz Ahmad I'm Sheeraz Ahmad, a web developer based in India. Top Bodybuilding Supplements Tips. L-Glutamine and Hunger Pangs. Leave a Reply Cancel reply You must be logged in to post a comment. Frequently Asked Questions.

Have Questions? Contact Us. Our Refund Process. Our Shipping Process. In Store purchase. Your Question. Shop Account Login. Products search. Use Phone Number. Use Email Address. Remember Me. Not a member yet? Register Now. Reset Password. Email Address.

Phone Number. Already a member? Login Now.

: Glutamine and cognitive function

Does Glutamine Boost Testosterone?	Impaired insulin secretion in a mouse model of ataxia telangiectasia. Leave a Comment. Effects of aged garlic extract on cholinergic, glutamatergic and GABAergic systems with regard to cognitive impairment in Aβ-induced rats. Several studies show that adding glutamine to enteral nutrition tube feeding helps reduce the rate of death in trauma and critically ill people. CAS PubMed Google Scholar Yoshida, C. There are substantial individual differences in human achievement in various life domains, from education to work or sports [ 1 , 2 ]. To dissect motivation into its component elements, we used a recently developed effort-based monetary incentivized task [ 21 ] that combines aspects from the MID task [ 10 ] and effort-based decision-making paradigms [ 11 , 22 ].
Genetic Life	However, further targeted studies are needed to elucidate the exact mechanisms behind the efficacy of free l -Glu. Article CAS PubMed PubMed Central Google Scholar Clem BF, Chesney J. Motivation related to work: a century of progress. Engholm-Keller K, et al. JC drafted the manuscript. Hexokinase 2 is a key mediator of aerobic glycolysis and promotes tumor growth in human glioblastoma multiforme. We did not detect differences in the labelling of [U- 13 C] glutamate in FTD3 neurons compared with isogenic controls which suggests that the transport of glutamate into neurons is unaffected.
ORIGINAL RESEARCH article	Glutamate , the excitatory neurotransmitter and GABA , the calming neurotransmitter rely on this cycle to maintain homeostasis within your brain. Glutamine also modulates the synthesis of Nitric Oxide by controlling the supply of its precursor arginine. When this cycle gets out of whack, things start to break down. The results can be particularly nasty. And result in conditions like epilepsy, or hepatic encephalopathy which effects behavior, mood, speech, sleep and the way you move. And you need to replenish L-glutamine levels either through supplementation or food. L-glutamine can be found in foods such as beef, pork, fish, eggs, milk and dairy products, wheat, cabbage, beets, beans, spinach and parsley. The normal cycling of glutamine and glutamate takes a huge amount of energy in the brain. One Korean study measured Glutamate and Glutamine concentrations in the prefrontal cortex of mice infused with an astrocyte toxin. Glutamate and glutamine levels decreased on the 5 th day in the mice. The animals experienced immobility and a decreased preference for sucrose sugar. A sure indication in mice of depression. Direct infusion of L-glutamine completely reversed all the impairments that were originally induced in the animals. And the researchers concluded that neuronal deficiency of L-glutamine causes depression. A study at the New York University School of Medicine used 28 patients with mild traumatic brain injury and 22 matched controls. The study found that one year after traumatic brain injury there was significant global brain atrophy. Much larger than in the control subjects. The team noted the amount of brain damage from just one concussion. And that this type of injury was not exclusive to a severe blow to the head. Even mild injury could cause brain damage. Low levels of L-glutamine are associated with a variety of health problems. When your neurotransmitters, including L-glutamine and glutamate are in balance, you feel motivated, productive and energetic. And you feel calm and relaxed during downtime. Many people in this L-glutamine -slump resort to high carbohydrate foods, and drugs or alcohol to relax. The amino acid L-glutamine is the precursor to L-glutamate production in your body. L-glutamate gets converted to GABA. Which is responsible for attention span, brain energy, learning ability, memory , and staying awake. An enzyme called glutamate decarboxylase converts glutamate to GABA. It does it with the help of the active form of Vitamin B 6 PyridoxalPhosphate P5P. The amino acid taurine helps increase the communication and productivity of this enzyme. And zinc helps the release of GABA from its receptors. Focus, concentration, memory and mood all improve. Supplementing with L-glutamine can improve your quality of life, increase energy levels, reduce muscle aches, improve digestion and gut health, improve quality of sleep, and reduce pain and fatigue. When you balance L-glutamine levels in your brain, you feel relaxed and calm. Cravings for sugar and alcohol will decline. L-glutamine will help in recovery from workouts and improve performance. You may find it easier to lose weight. L-glutamine was identified as a neurotransmitter several decades ago. And there has been a lot of research on L-glutamine published since. But most of it is focused on strength training and maintaining muscle mass in athletes. And for people healing from surgery or recovering from illness. But L-glutamine can be a powerful nootropic as well. Here are a couple of studies looking at L-glutamine for brain health. Bodybuilders and athletes use supplementary L-glutamine to help repair and build muscle. And there are several studies supporting the notion that L-glutamine increases Human Growth Hormone. In one study, researchers worked with 9 healthy subjects and gave them 2 grams of L-glutamine in a cola drink. Blood samples were taken before drinking the cola-spiked drink, then again at 30 mins. The researchers found that both blood L-glutamine and human growth hormone levels were significantly higher than before taking L-glutamine. Human growth hormone and Brain-Derived Neurotrophic Factor BDNF are intricately linked. BDNF is involved in Long-Term Potentiation and the encoding of long-term memories. Lack of concentration and poor memory can be improved by supplementing with L-glutamine with Vitamin B 3 niacin. Some of the glutamine in your blood is transformed into glutamic acid in your brain. Glutamic acid functions first as fuel, but it also gets rid of excess ammonia by binding to this cellular toxin and converting it into glutamine. A study in the Netherlands conducted a randomized, double-blind, placebo controlled trial with 42 healthy men and woman aged 40 — 76 years. Subjects received a 5-gram stack containing glycine, L-glutamine and niacin twice daily for 3 weeks. It was insulin-like growth factor-I that improved memory and vigor. Attributed to the L-Glutamine stack the subjects took for 3 weeks. And why adding L-glutamine to your nootropic stack can boost your immune system, improve your ability to fight infection and diseases, and boost cognition. Rarely do people report side effects like nausea, vomiting, flatulence, abdominal pain, constipation, dry mouth, hemorrhoids, dizziness, depression, skin rashes, insomnia and increased sweating. Some recent research has shown that L-glutamine can stimulate tumor growth. So if you are dealing with any form of cancer you should not use L-glutamine. If you are dealing with cirrhosis of the liver, you should avoid L-glutamine. If you are allergic or sensitive to Monosodium G lutamate MSG , you may be sensitive to L-glutamine because your body converts it to glutamate. And if you have a severe mental disorder including mania or frequently have seizures you may want to avoid L-glutamine. Trans-Alanyl or Alanyl-L-glutamine is an amino acid attached to another amino acid which aids in digestion of this supplement. If you are using it to boost athletic performance and speed recovery, both forms of L-glutamine are best taken right before or after a workout. Using it with small meals before or after your workout session can help support your metabolism and weight loss goals. And will assist in muscle building, recovery and maintenance. As a nootropic I recommend: Life Extension — L-Glutamine. And to calm or keep in check some of the stimulatory effects of some nootropics. Your body does make L-glutamine on its own from glutamate in your brain. But most people do not maintain an adequate supply of L-glutamine in their system. We suggest trying a L-glutamine supplement first at a dose of mg. And see how you react. You can safely dose up to 20 grams of L-glutamine per day. But most neurohackers find much lower doses effective for boosting cognition , mood and memory. As an Amazon Associate I earn from qualifying purchases. This post may also contain other affiliate links and I will be compensated if you make a purchase after clicking on my links. Keep up to date with the latest developments in the nootropics space. Eliminate Brain Fog, Low Energy, Moodiness, Difficulty Sleeping, Memory Loss or Anxiety. Wondering where to buy the best nootropic supplements? Because here you will find the nootropic supplements that I personally use and recommend. Each supplement has a link to the company store and product that I use. I also include a link to my full review for each supplement here […]. In fact, inadequate L-glutamine levels in your body can have harmful effects on your health. Some recent studies have associated glutamine depletion with increased mortality on the extreme side. For this reason, critically ill patients are often given a glutamine supplement. png hphstore 5 L-Glutamine Benefits for Your Gut, Brain, Muscles and More You might also like Why supplement with L-Glutamine? If you think L-glutamine is only for athletes, think again. Indeed, L-glutamine powder and supplements have long been promoted in the fitness industry because they help to build healthy and lean bodies. Yet, L-glutamine is possibly one of the most vital but underrated supplements for everyone. This powerful amino acid provides many essential health benefits for gut and brain health, immune function, and more. These include, but are not limited to: Promotes a healthy gut Boosts the immune system Stabilises blood sugar Reduces the symptoms of stress Boosts muscle recovery Top 5 Benefits of L-Glutamine L-glutamine is the most abundant amino acid found in muscle tissue and a significant building block of protein. L-glutamine Boosts the Immune System L-glutamine plays a vital role in gut health. L-glutamine Helps to Stabilise Blood Sugar When you experience a craving for carbohydrates, your brain usually wants sugar or glucose. L-glutamine Helps Reduce Symptoms of Stress In part, L-glutamine is used by the brain to build and balance the neurotransmitter GABA. L-glutamine Boosts Muscle Recovery Your body needs lots of protein and amino acids to help your muscles recover after a workout. Takeaway L-glutamine powder may traditionally be used to burn fat and build muscle, but evidence shows that there are far wider benefits. Human Performance Hub recommends these pharmaceutical-grade L-glutamine powders: BUY L-GLUTAMINE. You might also like Why supplement with L-Glutamine? Featured Supplement: Methyl Komplex. Everything you need to know about Vitamin K. Featured Supplement: Chlorella. The Benefits of Curcumin and How It Can Help. The benefits of supplementing with Licorice and helping with better morning energy. Clinical studies show that taking glutamine supplements strengthens the immune system and reduce infections, particularly infections associated with surgery. Glutamine may help prevent or treat multiple organ dysfunction after shock or other injuries among people in the intensive care unit. Glutamine supplements may also help in the recovery of severe burns. Glutamine helps protect the lining of the gastrointestinal tract known as the mucosa. For that reason, some researchers believe that people who have IBD ulcerative colitis and Crohn disease may not have enough glutamine. However, two clinical trials found that taking glutamine supplements did not improve symptoms of Crohn disease. More research is needed. In the meantime, ask your doctor when deciding whether to use glutamine for IBD. People with HIV or AIDS often experience severe weight loss particularly loss of muscle mass. A few studies of people with HIV and AIDS have found that taking glutamine supplements, along with other important nutrients, including vitamins C and E, beta-carotene, selenium, and N-acetylcysteine, may increase weight gain and help the intestines better absorb nutrients. Athletes who train for endurance events like marathons may reduce the amount of glutamine in their bodies. It is common for them to catch a cold after an athletic event. Some experts think that may be because of the role glutamine plays in the immune system. For this select group of athletes, one study showed that taking glutamine supplements resulted in fewer infections. The same is not true, however, for exercisers who work out at a moderate intensity. Many people with cancer have low levels of glutamine. For this reason, some researchers speculate that glutamine may be helpful when added to conventional cancer treatment. Supplemental glutamine is often given to malnourished cancer patients undergoing chemotherapy or radiation treatments, and sometimes used in people undergoing bone marrow transplants. Glutamine seems to help reduce stomatitis an inflammation of the mouth caused by chemotherapy. Some studies suggest that taking glutamine orally may help reduce diarrhea associated with chemotherapy. More clinical research is needed to know whether glutamine is safe or effective to use as part of the treatment regimen for cancer. Dietary sources of glutamine include plant and animal proteins such as beef, pork, poultry, milk, yogurt, ricotta cheese, cottage cheese, raw spinach, raw parsley, and cabbage. Glutamine, usually in the form of L-glutamine, is available by itself, or as part of a protein supplement. These come in powders, capsules, tablets, or liquids. Take glutamine with cold or room temperature foods or liquids. It should not be added to hot beverages because heat destroys glutamine. For children 10 years and younger: DO NOT give glutamine to a child unless your pediatrician recommends it as part of a complete amino acid supplement. Because of the potential for side effects and interactions with medications, you should take dietary supplements only under the supervision of a knowledgeable health care provider. You should only take high doses under the supervision of a physician. Glutamine powder should not be added to hot beverages because heat destroys glutamine. Glutamine supplements should also be kept in a dry location. People with kidney disease, liver disease, or Reye syndrome a rare, sometimes fatal disease of childhood that is generally associated with aspirin use should not take glutamine. People who have psychiatric disorders, or who have a history of seizures, should use caution when considering supplementation with glutamine. Some researchers feel that taking glutamine may worsen these conditions. Many elderly people have decreased kidney function, and may need to reduce their dose of glutamine. Glutamine is different from glutamate glutamic acid , monosodium glutamate, and gluten. Glutamine should not cause symptoms headaches, facial pressure, tingling, or burning sensation associated with sensitivity to monosodium glutamate. People who are gluten sensitive can use glutamine without problems. However, some people may be sensitive to glutamine, which is completely separate from gluten. Lactulose: Glutamine supplementation can increase ammonia in th body, so taking glutamine may make lactulose less effective. Cancer therapy: Glutamine may increase the effectiveness and reduce the side effects of chemotherapy treatments with doxorubicin, methotrexate, and 5-fluorouracil in people with colon cancer. Preliminary studies suggest that glutamine supplements may prevent nerve damage associated with a medication called paclitaxel used for breast and other types of cancers. However, laboratory studies suggest that glutamine may actually stimulate growth of tumors. More research is needed before researchers can determine whether it is safe to use glutamine if you have cancer. If you are receiving chemotherapy, you should never add supplements to your regimen without consulting your doctor. Abcouwer SF. The effects of glutamine on immune cells [editorial]. Agostini F, Giolo G. Effect of physical activity on glutamine metabolism. Curr Opin Clin Nutr Metab Care. Akobeng AK, Miller V, Stanton J, Elbadri AM, Thomas AG. Double-blind randomized controlled trial of glutamine-enriched polymeric diet in the treatment of active Crohn's disease. J Pediatr Gastroenterol Nutr. Antoon AY, Donovan DK. Burn Injuries. In: Behrman RE, Kliegman RM, Jenson HB, eds. Nelson Textbook of Pediatrics.
The Health Benefits of Glutamine	So, what are the benefits of L-glutamine? L-glutamine powders and supplements offer a number of health benefits for everyone, not just athletes. These include, but are not limited to:. L-glutamine is the most abundant amino acid found in muscle tissue and a significant building block of protein. Your body requires a lot of L-glutamine, therefore, supplementing with L-glutamine powder is an excellent way to ensure that your body gets enough to provide the following benefits. Today we know even more about the gut-health connection and how your gut impacts your health in many ways. It also helps to seal and maintain the gut lining. Decreasing intestinal permeability helps heal leaky gut , a condition that can cause autoimmune diseases and other serious health issues. I recommend the HPH GI Regenerate Powder as an all-around supplement to support and improve your gut health. L-glutamine plays a vital role in gut health. Intense training sessions, illness and general lack of wellbeing places the body under a great deal of stress that naturally suppresses the immune system. When you experience a craving for carbohydrates, your brain usually wants sugar or glucose. L-glutamine works as a healthy alternative to sugar as it fuels similar brain receptors. L-glutamine helps suppress insulin levels and stabilise blood glucose benefits, which benefits people with diabetes and those with sugar and carb cravings. Lowering cravings for sugar and processed carbs, and by extension, eating less of them helps control blood sugars and inflammation that would slow down your recovery. Drink or spoon it as a dessert, mixing in a handful of fresh raspberries or blueberries — delicious! In part, L-glutamine is used by the brain to build and balance the neurotransmitter GABA. There is growing evidence that L-glutamine and GABA play a significant role in mood and anxiety disorders. Over time, chronic stress can cause serious health problems. Increasing L-glutamine levels may also reduce symptoms of stress-related IBS. When the body is stressed, it releases the hormone cortisol, which can lower L-glutamine levels stored in the muscle tissue. Your body needs lots of protein and amino acids to help your muscles recover after a workout. L-glutamine is the perfect post-workout supplement as it boosts muscle recovery by increasing protein intake to build muscle, up-regulate the immune system, and improve the gut to help lean out and build muscle. Heavy workout sessions can deplete your glutamine levels and, due to the stress placed on your body after working out, your muscles and tendons need significant amounts of glutamine. Supplementing with L-glutamine post-workout hydrates your muscles and triggers a boost in growth hormone. More growth hormone helps your body synthesise protein to build muscle, reduce recovery time, and mobilise fat from storage to make it available for energy. Supplementing with just 80g of L-glutamine throughout the day provides a protein intake equivalent to g of meat! This should be taken with Magnesium Bisglycinate. After a while, you can then increase your intake with another 10g in the morning, mixed with lime, salt and water. Eventually, you should be able to increase your intake to 8 X 10g servings of L-glutamine per day. L-glutamine powder may traditionally be used to burn fat and build muscle, but evidence shows that there are far wider benefits. Biochemical and immunological changes on oral glutamate feeding in male albino rats. Nakamura, H. Removal of glutamate from diet suppresses fat oxidation and promotes fatty acid synthesis in rats. FASEB J. Yanni, A. Oral supplementation with l -aspartate and l -glutamate inhibits atherogenesis and fatty liver disease in cholesterol-fed rabbit. Amino Acids 38 5 , — Kanunnikova, N. Role of brain glutamic acid metabolism changes in neurodegenerative pathologies. Earth Sci. Mattson, M. Glutamate and neurotrophic factors in neuronal plasticity and disease. ADS CAS PubMed PubMed Central Google Scholar. Sanacora, G. Clinical studies implementing glutamate neurotransmission in mood disorders. Park, C. Glutamate and aspartate impair memory retention and damage hypothalamic neurons in adult mice. Tamminga, C. Glutamate dysfunction in hippocampus: Relevance of dentate gyrus and CA3 signaling. Gécz, J. Glutamate receptors and learning and memory. Ikeda, K. New seasonings. Senses 27 9 , — Patel, A. Hertz, L. Brain Res. Asrani, V. Glutamine supplementation in acute pancreatitis: A meta-analysis of randomized controlled trials. Pancreatology 13 5 , — Stamoula, E. Low dose administration of glutamate triggers a non-apoptotic, autophagic response in PC12 cells. Madhavadas, S. The neuroprotective effect of dark chocolate in monosodium glutamate-induced nontransgenic Alzheimer disease model rats: Biochemical, behavioral, and histological studies. Dietary Suppl. CAS Google Scholar. Tabassum, S. Chronic choline supplementation improves cognitive and motor performance via modulating oxidative and neurochemical status in rats. Monosodium glutamate-associated alterations in open field, anxiety-related and conditioned place preference behaviours in mice. McEntee, W. Glutamate: Its role in learning, memory, and the aging brain. Kowluru, R. Retinal glutamate in diabetes and effect of antioxidants. Greenamyre, J. The role of glutamate in neurotransmission and in neurologic disease. Dietary l -aspartate and l -glutamate inhibit fatty streak initiation in cholesterol-fed rabbit. López-Miranda, V. Effects of chronic dietary exposure to monosodium glutamate on feeding behavior, adiposity, gastrointestinal motility, and cardiovascular function in healthy adult rats. Otter, S. Exciting times for pancreatic islets: glutamate signaling in endocrine cells. Trends Endocrinol. Meyer-Gerspach, A. Gut taste stimulants alter brain activity in areas related to working memory: A pilot study. Neurosignals 24 1 , 59—70 Garlick, P. The nature of human hazards associated with excessive intake of amino acids. Tapiero, H. Glutamine and glutamate. Abu-Taweel, G. Cognitive and biochemical effects of monosodium glutamate and aspartame, administered individually and in combination in male albino mice. Xu, L. The roles of metallothionein on cadmium-induced testes damages in Sprague-Dawley rats. Lobo, V. Free radicals, antioxidants and functional foods: Impact on human health. CAS PubMed PubMed Central Google Scholar. Ni, H. Effects of glutamate and aspartate on serum antioxidative enzyme, sex hormones, and genital inflammation in boars challenged with hydrogen peroxide. Mediators Inflamm. Article CAS PubMed PubMed Central Google Scholar. Agarwal, A. Clinical relevance of oxidative stress in male factor infertility: An update. Li, Y. Antioxidant and free radical-scavenging activities of chickpea protein hydrolysate CPH. Food Chem. Cynober, L. Metabolism of dietary glutamate in adults. Tomé, D. The roles of dietary glutamate in the intestine. Han, D. Protection against glutamate-induced cytotoxicity in C6 glial cells by thiol antioxidants. Oxidative stress-mediated signaling pathways: A review. Food Agric. Deng, Y. Riluzole-triggered GSH synthesis via activation of glutamate transporters to antagonize methylmercury-induced oxidative stress in rat cerebral cortex. Oxidative Med. Blachier, F. Metabolism and functions of l -glutamate in the epithelial cells of the small and large intestines. Mufson, E. Cholinotrophic molecular substrates of mild cognitive impairment in the elderly. Alzheimer Res. Thorajak, P. Effects of aged garlic extract on cholinergic, glutamatergic and GABAergic systems with regard to cognitive impairment in Aβ-induced rats. PubMed Central Google Scholar. Aigner, T. Pharmacology of memory: Cholinergic—glutamatergic interactions. Farr, S. The effect of cholinergic, GABAergic, serotonergic, and glutamatergic receptor modulation on posttrial memory processing in the hippocampus. Nilsen, L. Glutamate metabolism is impaired in transgenic mice with tau hyperphosphorylation. Blood Flow Metab. Haider, S. Scopolamine-induced greater alterations in neurochemical profile and increased oxidative stress demonstrated a better model of dementia: A comparative study. National Research Council, Guide for the Care and Use of Laboratory Animals. National Academies Press, Washington, DC, Nair, A. A simple practice guide for dose conversion between animals and human. Basic Clin. Impact of oral supplementation of Glutamate and GABA on memory performance and neurochemical profile in hippocampus of rats. Impact of 1-day and 4-day MWM training techniques on oxidative and neurochemical profile in rat brain: A comparative study on learning and memory functions. Download references. Authors are thankful to University of Karachi and Higher Education Commission HEC , Pakistan for their support and funding to carry out the current study. Authors are also thankful to ICCBS, University of Karachi for giving access to use Fluorometric ELISA reader. The experimental material and animals used in the current study were funded by University of Karachi and Higher Education Commission HEC , Pakistan. Authors also declare that there are no competing financial interests in relation to the work described. Neurochemistry and Biochemical Neuropharmacology Research Unit, Department of Biochemistry, University of Karachi, Karachi, , Pakistan. Department of Biosciences, Faculty of Life Science, Shaheed Zulfiqar Ali Bhutto Institute of Science and Technology Szabist , Karachi, Pakistan. Department of Biological and Biomedical Sciences, Aga Khan University Hospital, Karachi, Pakistan. Panjwani Center for Molecular Medicine and Drug Research, International Center for Chemical and Biological Sciences, University of Karachi, Karachi, , Pakistan. You can also search for this author in PubMed Google Scholar. Author S. wrote the main manuscript text and performed the statistical analysis and formatting of the manuscript, S. given the idea, supervise the whole work and reviewed the main manuscript text and figures, S. performed the experimental work and gathered the data. All authors reviewed the manuscript. Correspondence to Saida Haider. Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4. Reprints and permissions. Free l -glutamate-induced modulation in oxidative and neurochemical profile contributes to enhancement in locomotor and memory performance in male rats. Sci Rep 10 , Download citation. Received : 20 July Accepted : 04 May Published : 08 July Anyone you share the following link with will be able to read this content:. Sorry, a shareable link is not currently available for this article. Provided by the Springer Nature SharedIt content-sharing initiative. By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate. Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily. Skip to main content Thank you for visiting nature. nature scientific reports articles article. Download PDF. Subjects Biochemistry Cognitive neuroscience Learning and memory Neuroscience. Abstract Glutamate Glu , the key excitatory neurotransmitter in the central nervous system, is considered essential for brain functioning and has a vital role in learning and memory formation. Introduction Central nervous system CNS modulates behaviour and brain functioning with the help of multiple neurotransmitters. Results The aim of the current study is to find out the effects of free l -Glu on locomotor activity and learning and cognitive functioning along with monitoring alterations in oxidative profile and neurochemical content in the brain as shown in Fig. Figure 1. Schematic representation of treatment schedule and experimental design. Full size image. Table 1 Effects of dietary free glutamate supplementation on weekly food intake and the body weight of animals during treatment. Full size table. Figure 2. Figure 3. Figure 4. Figure 5. Figure 6. Discussion The current study found improvement in motor activity and learning and memory performance following chronic supplementation of free l -Glu via modulating the neurochemical and redox status in the brain. Figure 7. Schematic representation of findings following chronic supplementation of free Glu in rats. Drugs Glutamate Solgar, USA tablets available commercially used during the study were purchased from Kousar Medicos. Behavioral protocols Food intake and body weight Food intake and body weight of rats was monitored daily during the 5 weeks of the treatment as described previously 32 see details in the supplementary file. Assessment of locomotor performance Locomotor performance of rats was assessed by using OFT to assess ambulatory activity, KIST and BWT to determine muscular strength and motor co-ordination. Memory assessment Memory performance of rats was monitored by using NORT to determine recognition ability, MWM and PAT for assessing the spatial reference and associative memory performance. Sample collection For dissecting out the brain rats were decapitated 24 h after the behavioral analysis and their brains were taken out within 30 s and dipped in ice-cold saline. Ethical approval The authors declare that the procedures performed in this study were in accordance with all applicable international, national, and institutional guidelines for the care and use of animals. Data availability Authors will provide data upon request. References Onaolapo, O. CAS PubMed Google Scholar Brosnan, J. CAS PubMed Google Scholar Yoshida, C. Google Scholar Duan, J. ADS PubMed PubMed Central Google Scholar Jiao, N. CAS PubMed Google Scholar Dutta, S. Google Scholar Tsurugizawa, T. PubMed Google Scholar Yüksel, C. PubMed Google Scholar Jinap, S. CAS PubMed Google Scholar Tomoe, M. ADS CAS PubMed Google Scholar Yamamoto, S. CAS PubMed Google Scholar Somekawa, S. CAS PubMed Google Scholar Ishibashi-Shiraishi, I. CAS PubMed Google Scholar Lin, M. ADS PubMed PubMed Central Google Scholar Yin, J. PubMed PubMed Central Google Scholar Demircan, C. CAS PubMed Google Scholar Kumar, D. ADS CAS PubMed Google Scholar Nakamura, H. Google Scholar Yanni, A. CAS PubMed Google Scholar Kanunnikova, N. Google Scholar Mattson, M. ADS CAS PubMed PubMed Central Google Scholar Sanacora, G. ADS CAS PubMed Google Scholar Park, C. CAS PubMed Google Scholar Tamminga, C. PubMed PubMed Central Google Scholar Gécz, J. PubMed Google Scholar Ikeda, K. PubMed Google Scholar Patel, A. ADS CAS PubMed Google Scholar Hertz, L. CAS PubMed Google Scholar Asrani, V. CAS PubMed Google Scholar Stamoula, E. CAS PubMed Google Scholar Madhavadas, S. CAS Google Scholar Tabassum, S. CAS PubMed Google Scholar Onaolapo, O. Google Scholar McEntee, W. CAS PubMed Google Scholar Kowluru, R. CAS PubMed Google Scholar Greenamyre, J. CAS PubMed Google Scholar Yanni, A. CAS PubMed Google Scholar López-Miranda, V. PubMed Google Scholar Otter, S. CAS PubMed Google Scholar Meyer-Gerspach, A. PubMed Google Scholar Garlick, P. CAS PubMed Google Scholar Tapiero, H. CAS PubMed Google Scholar Abu-Taweel, G. CAS PubMed Google Scholar Xu, L. CAS PubMed Google Scholar Lobo, V. CAS PubMed PubMed Central Google Scholar Ni, H. Article CAS PubMed PubMed Central Google Scholar Agarwal, A. CAS PubMed Google Scholar Li, Y. CAS Google Scholar Cynober, L. CAS PubMed Google Scholar Tomé, D. PubMed Google Scholar Han, D. CAS Google Scholar Yin, J. Google Scholar Deng, Y.

Glutamine and cognitive function -

Close Sidebar. Recent Post Is Grass-Fed Whey Protein Right For You? Creatine: Essential Factors to Consider Before Taking 29 December Add to wishlist Add to wishlist. Bio Whey UMF Whey Protein Powder. Regular price From Rs. Regular price Rs. Choose Options. Mass Attack Superior Mass Gainer.

GENETIC NUTRITION MASS ATTACK: Mass Attack is the ultimate weight gain and muscle-building formula. With over calories per serving and 28g of protein to support muscle recovery, Mass Attack is a Hi-Calorie, Hi-Protein formula that makes the ideal post-workout and between-meals shake for Glutamine and Mental Performance: Enhancing Focus and Cognitive Function by SEO DIGITAL 01 Sep Glutamine — what it means?

Glutamine — Benefits Glutamine is an essential component to maintain a healthy body and mind. Below given is a list of Glutamine benefits briefly: Glutamine helps in the cell division of white blood cells. It has healing properties and in the absence of enough glutamine in our body, wound healing takes longer.

Glutamine plays a vital role in fighting infections and boosts immunity. Most hospitals opt for glutamine to cure infectious diseases. It can cure peptic ulcers, mouth ulcers, muscle strains, joint pains, and side effects from chemotherapy in cancer patients.

Athletes trust L Glutamine supplements to prevent the effects of strenuous physical training sessions. It improves performance and makes post-workout recovery faster.

It also has bodybuilding properties for increased muscle mass and strength. Some reports have proven glutamine usage to be effective in anti-aging treatment. It is also a safe alternative to steroids in stimulating testosterone levels when applied in an injectable form.

Other Glutamine uses — treating mental disorders Several research and clinical studies have revealed that glutamine can cure sexual dysfunction. Dosage and Recommendations As we explored multiple uses of glutamine in the medical and sports field, we should also discuss the precautions regarding the consumption of glutamine.

When you should avoid glutamines Glutamines are best to consume by mixing them with protein shakes. Concluding Remarks Taking into consideration all the benefits that glutamines offer, it is advised to seek expert advice over self-prescription. All the reagents for experiments were prepared fresh before starting the experiment.

For oral administration drug solutions were made fresh each day. Tablets were dissolved in distilled water. Controls received equal volume of distilled water.

The selection of dose was done in accordance with the prescription given on the tablets and from this human recommended dose the animal equivalent dose AED was calculated as mentioned by Nair and Jacob, The period of experimentation was 5 weeks.

At the end of treatment, the behavioural analysis was conducted as presented in the Fig. Subsequent to behavioural analysis, rats were decapitated to dissect out their brains from the skull as described by Tabassum et al.

Hippocampus was also dissected out as described previously Food intake and body weight of rats was monitored daily during the 5 weeks of the treatment as described previously 32 see details in the supplementary file.

Locomotor performance of rats was assessed by using OFT to assess ambulatory activity, KIST and BWT to determine muscular strength and motor co-ordination.

The apparatus and procedures used for all these tasks were exactly similar as described earlier 63 which is provided in detail in the supplementary file. Memory performance of rats was monitored by using NORT to determine recognition ability, MWM and PAT for assessing the spatial reference and associative memory performance.

The apparatus and procedures used for all these tasks were essentially the same as described previously The details of the procedures are provided in the supplementary file. For dissecting out the brain rats were decapitated 24 h after the behavioral analysis and their brains were taken out within 30 s and dipped in ice-cold saline.

Thereafter, immediately placed in brain slicer with ventral side up to dissect out the hippocampus as previously mentioned 60 , 63 by inserting the blade at into the slots of the brain slicer just above and below the hypothalamus, to cut the brain into three slices which were then shifted to a petri dish placed on ice, moistened with chilled saline 0.

The middle slice was used to dissect out hippocampus bilaterally with the help of sharp scalpel blade. For further reading refer to the supplementary file.

After homogenization, the samples were placed inside the refrigerator for 15 min to aid the precipitation and then centrifuged at 10, rpm for 15 min at 4 °C to precipitate out the protein. The supernatant was collected for determining the GLU, GABA and monoamine content in brain samples.

Thereafter, the content of acetylcholine ACh , Glu and GABA was estimated in the same manner as determined by Tabassum et al. The activity of Acetylcholinesterase AChE and the concentration of monoamines NA, DA, 5-HT and its metabolites DOPAC, HVA and 5-HIAA in the brain and hippocampus was determined as described by Haider et al.

The authors declare that the procedures performed in this study were in accordance with all applicable international, national, and institutional guidelines for the care and use of animals. Onaolapo, O.

Pathophysiology 23 3 , — CAS PubMed Google Scholar. Brosnan, J. Glutamate: A truly functional amino acid. Amino Acids 45 3 , — Yoshida, C. Glutamate promotes nucleotide synthesis in the gut and improves availability of soybean meal feed in rainbow trout.

SpringerPlus 5 1 , 1—12 Google Scholar. Duan, J. et al. Dietary glutamate supplementation ameliorates mycotoxin-induced abnormalities in the intestinal structure and expression of amino acid transporters in young pigs.

PLoS ONE 9 11 , e ADS PubMed PubMed Central Google Scholar. Jiao, N. l -glutamate enhances barrier and antioxidative functions in intestinal porcine epithelial cells. Dutta, S. Glutamic acid as anticancer agent: An overview.

Saudi Pharmaceut. Tsurugizawa, T. Different BOLD responses to intragastric load of l -glutamate and inosine monophosphate in conscious rats.

Senses 36 2 , — PubMed Google Scholar. Yüksel, C. Magnetic resonance spectroscopy studies of glutamate-related abnormalities in mood disorders. Jinap, S. Glutamate: Its applications in food and contribution to health. Tomoe, M. Clinical trial of glutamate for the improvement of nutrition and health in the elderly.

ADS CAS PubMed Google Scholar. Yamamoto, S. Can dietary supplementation of monosodium glutamate improve the health of the elderly?. Somekawa, S. Dietary free glutamate prevents diarrhoea during intra-gastric tube feeding in a rat model.

Ishibashi-Shiraishi, I. l -Arginine l -glutamate enhances gastric motor function in rats and dogs and improves delayed gastric emptying in dogs. Lin, M. l -Glutamate supplementation improves small intestinal architecture and enhances the expressions of jejunal mucosa amino acid receptors and transporters in weaning piglets.

Yin, J. Effects of dietary supplementation with glutamate and aspartate on diquat-induced oxidative stress in piglets. PLoS ONE 10 4 , e PubMed PubMed Central Google Scholar. Demircan, C. High glutamate attenuates SB and LDH outputs from rat cortical slices enhanced by either oxygen-glucose deprivation or menadione.

Kumar, D. Biochemical and immunological changes on oral glutamate feeding in male albino rats. Nakamura, H. Removal of glutamate from diet suppresses fat oxidation and promotes fatty acid synthesis in rats. FASEB J. Yanni, A. Oral supplementation with l -aspartate and l -glutamate inhibits atherogenesis and fatty liver disease in cholesterol-fed rabbit.

Amino Acids 38 5 , — Kanunnikova, N. Role of brain glutamic acid metabolism changes in neurodegenerative pathologies. Earth Sci. Mattson, M. Glutamate and neurotrophic factors in neuronal plasticity and disease. ADS CAS PubMed PubMed Central Google Scholar. Sanacora, G.

Clinical studies implementing glutamate neurotransmission in mood disorders. Park, C. Glutamate and aspartate impair memory retention and damage hypothalamic neurons in adult mice.

Tamminga, C. Glutamate dysfunction in hippocampus: Relevance of dentate gyrus and CA3 signaling. Gécz, J. Glutamate receptors and learning and memory.

Ikeda, K. New seasonings. Senses 27 9 , — Patel, A. Hertz, L. Brain Res. Asrani, V. Glutamine supplementation in acute pancreatitis: A meta-analysis of randomized controlled trials.

Pancreatology 13 5 , — Stamoula, E. Low dose administration of glutamate triggers a non-apoptotic, autophagic response in PC12 cells. Madhavadas, S. The neuroprotective effect of dark chocolate in monosodium glutamate-induced nontransgenic Alzheimer disease model rats: Biochemical, behavioral, and histological studies.

Dietary Suppl. CAS Google Scholar. Tabassum, S. Chronic choline supplementation improves cognitive and motor performance via modulating oxidative and neurochemical status in rats.

Monosodium glutamate-associated alterations in open field, anxiety-related and conditioned place preference behaviours in mice. McEntee, W. Glutamate: Its role in learning, memory, and the aging brain. Kowluru, R.

Retinal glutamate in diabetes and effect of antioxidants. Greenamyre, J. The role of glutamate in neurotransmission and in neurologic disease.

Dietary l -aspartate and l -glutamate inhibit fatty streak initiation in cholesterol-fed rabbit. López-Miranda, V. Effects of chronic dietary exposure to monosodium glutamate on feeding behavior, adiposity, gastrointestinal motility, and cardiovascular function in healthy adult rats.

Otter, S. Exciting times for pancreatic islets: glutamate signaling in endocrine cells. Trends Endocrinol. Meyer-Gerspach, A. Gut taste stimulants alter brain activity in areas related to working memory: A pilot study.

Neurosignals 24 1 , 59—70 Garlick, P. The nature of human hazards associated with excessive intake of amino acids. Tapiero, H. Glutamine and glutamate. Abu-Taweel, G. Cognitive and biochemical effects of monosodium glutamate and aspartame, administered individually and in combination in male albino mice.

Xu, L. The roles of metallothionein on cadmium-induced testes damages in Sprague-Dawley rats. Lobo, V. Free radicals, antioxidants and functional foods: Impact on human health. CAS PubMed PubMed Central Google Scholar. Ni, H. Effects of glutamate and aspartate on serum antioxidative enzyme, sex hormones, and genital inflammation in boars challenged with hydrogen peroxide.

Mediators Inflamm. Article CAS PubMed PubMed Central Google Scholar. Agarwal, A. Clinical relevance of oxidative stress in male factor infertility: An update. Li, Y. Antioxidant and free radical-scavenging activities of chickpea protein hydrolysate CPH. Food Chem. Cynober, L. Metabolism of dietary glutamate in adults.

Gatti RA, et al. The pathogenesis of ataxia-telangiectasia. Learning from a Rosetta Stone. Article CAS Google Scholar. Crawford TO, Skolasky RL, Fernandez R, Rosquist KJ, Lederman HM.

Survival probability in ataxia telangiectasia. Arch Dis Child. Yang Y, Hui CW, Li J, Herrup K. The interaction of the atm genotype with inflammation and oxidative stress. Article PubMed PubMed Central Google Scholar.

Hui CW, Herrup K. Individual cytokines modulate the neurological symptoms of ATM deficiency in a region specific manner. eNeuro in press. Google Scholar. McGrath-Morrow SA, et al. Elevated serum IL-8 levels in ataxia telangiectasia.

J Pediatr. Article CAS PubMed Google Scholar. Shanware NP, et al. Glutamine deprivation stimulates mTOR-JNK-dependent chemokine secretion. Nat Commun. Kim MH, Kim A, Yu JH, Lim JW, Kim H. Glutamine deprivation induces interleukin-8 expression in ataxia telangiectasia fibroblasts. Inflammation research : official journal of the European Histamine Research Society.

Woods CG, Taylor AM. Ataxia telangiectasia in the British Isles: the clinical and laboratory features of 70 affected individuals. The Quarterly journal of medicine.

CAS PubMed Google Scholar. Schubert R, Reichenbach J, Zielen S. Growth factor deficiency in patients with ataxia telangiectasia. Clin Exp Immunol. Kieslich M, et al. Ross LJ, et al.

Nutritional status of patients with ataxia-telangiectasia: a case for early and ongoing nutrition support and intervention. J Paediatr Child Health. Barlow C, et al. Atm-deficient mice: a paradigm of ataxia telangiectasia. Xu Y, Baltimore D.

Dual roles of ATM in the cellular response to radiation and in cell growth control. Genes Dev. Romito-DiGiacomo RR, Menegay H, Cicero SA, Herrup K. The Journal of neuroscience : the official journal of the Society for Neuroscience. Li J, Han YR, Plummer MR, Herrup K.

Cytoplasmic ATM in neurons modulates synaptic function. Current biology : CB. Li J, et al. EZH2-mediated H3K27 trimethylation mediates neurodegeneration in ataxia-telangiectasia. Nat Neurosci. Greenfield JR, et al. Oral glutamine increases circulating glucagon-like peptide 1, glucagon, and insulin concentrations in lean, obese, and type 2 diabetic subjects.

Am J Clin Nutr. Tolhurst G, et al. Calanna S, et al. Secretion of glucagon-like peptide-1 in patients with type 2 diabetes mellitus: systematic review and meta-analyses of clinical studies. Miles PD, Treuner K, Latronica M, Olefsky JM, Barlow C. Impaired insulin secretion in a mouse model of ataxia telangiectasia.

Am J Physiol Endocrinol Metab. Volkow ND, et al. Brain glucose metabolism in adults with ataxia-telangiectasia and their asymptomatic relatives. Brain : a journal of neurology.

Article Google Scholar. Vail G, et al. ATM protein is located on presynaptic vesicles and its deficit leads to failures in synaptic plasticity.

Journal of neurophysiology:jn. Genik PC, et al. Strain background determines lymphoma incidence in Atm knockout mice. Ortinski PI, et al. Selective induction of astrocytic gliosis generates deficits in neuronal inhibition.

Chen S, Wang G, Makrigiorgos GM, Price BD. Stable siRNA-mediated silencing of ATM alters the transcriptional profile of HeLa cells. Biochem Biophys Res Commun. Rotman G, Shiloh Y. ATM: a mediator of multiple responses to genotoxic stress.

Nicklin P, et al. Bidirectional transport of amino acids regulates mTOR and autophagy. Shen C, Houghton PJ. The mTOR pathway negatively controls ATM by up-regulating miRNAs. Proc Natl Acad Sci U S A. Alexander A, et al.

ATM signals to TSC2 in the cytoplasm to regulate mTORC1 in response to ROS. Nuclear accumulation of HDAC4 in ATM deficiency promotes neurodegeneration in ataxia telangiectasia. Nat Med. Patterson SL, et al. Some forms of cAMP-mediated long-lasting potentiation are associated with release of BDNF and nuclear translocation of phospho-MAP kinase.

Sakata K, et al. Critical role of promoter IV-driven BDNF transcription in GABAergic transmission and synaptic plasticity in the prefrontal cortex. Lamb BT, et al. Hum Mol Genet. Herrup K, Li J, Chen J. The role of ATM and DNA damage in neurons: upstream and downstream connections. DNA repair.

Rozas NS, et al. Prolonging the survival of Tsc2 conditional knockout mice by glutamine supplementation. Hiltunen JK, et al. Mitochondrial fatty acid synthesis and respiration. Biochim Biophys Acta. Valentin-Vega YA, et al. Mitochondrial dysfunction in ataxia-telangiectasia.

Yang DQ, Halaby MJ, Li Y, Hibma JC, Burn P. Cytoplasmic ATM protein kinase: an emerging therapeutic target for diabetes, cancer and neuronal degeneration. Drug Discov Today. Armata HL, et al.

Mol Cell Biol. Clem BF, Chesney J. Molecular pathways: regulation of metabolism by RB. Clinical cancer research : an official journal of the American Association for Cancer Research. Billups D, Marx MC, Mela I, Billups B.

Inducible presynaptic glutamine transport supports glutamatergic transmission at the calyx of Held synapse. Ruzzo EK, et al.

Deficiency of asparagine synthetase causes congenital microcephaly and a progressive form of encephalopathy. Scholl-Burgi S, et al. Article PubMed Google Scholar. Ligthart-Melis GC, et al.

Glutamine is an important precursor for de novo synthesis of arginine in humans. Kan MJ, et al. Hwang SY, et al. Son J, et al. Glutamine supports pancreatic cancer growth through a KRAS-regulated metabolic pathway. Wise DR, Thompson CB.

Glutamine addiction: a new therapeutic target in cancer. Trends Biochem Sci. Parry-Billings M, et al. The effect of tumour bearing on skeletal muscle glutamine metabolism.

The International journal of biochemistry. Yoshida S, Kaibara A, Ishibashi N, Shirouzu K. Glutamine supplementation in cancer patients. Yang L, et al. Metabolic shifts toward glutamine regulate tumor growth, invasion and bioenergetics in ovarian cancer.

Mol Syst Biol. Klimberg VS, et al. Glutamine suppresses PGE2 synthesis and breast cancer growth. J Surg Res. Lim V, Korourian S, Todorova VK, Kaufmann Y, Klimberg VS. Glutamine prevents DMBA-induced squamous cell cancer.

Oral Oncol. Rubio I, et al. Oral glutamine reduces radiation morbidity in breast conservation surgery. JPEN J Parenter Enteral Nutr. Download references. The authors thank Dr. Ping Xie for her help with plotting survival cure and statistics, Ms Li Deng and Dr.

Jay Tischfield for their support with real-time PCR. This work is supported by grants from the BrightFocus Foundation A, from NIH 1R01NS and from the Hong Kong Research Grants Council HKSAR GRF JC and KH designed the study.

YC, JC, LL carried out the blood glutamine, glucose, body weight and life span studies and involved in the data analysis. JC, YC, HC and YZ did the neuronal culture experiments RT-PCR, western blot and immunostaining and participated in data analysis. GV and MP carried out LTP recording experiments and data analysis.

JL and RH performed the expression studies and data analysis. JC drafted the manuscript. JC, KH, HC, RH and MP participated in the revision of the manuscript.

All authors read and approved the manuscript. All animal procedures were approved by the Rutgers University Institutional Animal Care and Use Committee protocol 06— Department of Cell Biology and Neuroscience, Rutgers University, Allison Road, Piscataway, NJ, , USA.

Jianmin Chen, Yanping Chen, Graham Vail, Lauren Louie, Jiali Li, Ronald P. Hart, Mark R. Division of Life Science, The Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong. Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan, China.

Thank you cognituve visiting nature. You are using Injury prevention in the workplace browser Glutamine and cognitive function with limited support for CSS. To obtain ckgnitive best experience, we G,utamine you qnd a more up to date browser Fasting for Reduced Inflammation turn off compatibility mode in Internet Explorer. In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript. Glutamate Gluthe key excitatory neurotransmitter in the central nervous system, is considered essential for brain functioning and has a vital role in learning and memory formation. Earlier it was considered as a harmful agent but later found to be useful for many body functions.

Glutamine and cognitive function -

Growth factor deficiency in patients with ataxia telangiectasia. Clin Exp Immunol. Kieslich M, et al. Ross LJ, et al. Nutritional status of patients with ataxia-telangiectasia: a case for early and ongoing nutrition support and intervention. J Paediatr Child Health.

Barlow C, et al. Atm-deficient mice: a paradigm of ataxia telangiectasia. Xu Y, Baltimore D. Dual roles of ATM in the cellular response to radiation and in cell growth control. Genes Dev.

Romito-DiGiacomo RR, Menegay H, Cicero SA, Herrup K. The Journal of neuroscience : the official journal of the Society for Neuroscience.

Li J, Han YR, Plummer MR, Herrup K. Cytoplasmic ATM in neurons modulates synaptic function. Current biology : CB. Li J, et al.

EZH2-mediated H3K27 trimethylation mediates neurodegeneration in ataxia-telangiectasia. Nat Neurosci. Greenfield JR, et al. Oral glutamine increases circulating glucagon-like peptide 1, glucagon, and insulin concentrations in lean, obese, and type 2 diabetic subjects.

Am J Clin Nutr. Tolhurst G, et al. Calanna S, et al. Secretion of glucagon-like peptide-1 in patients with type 2 diabetes mellitus: systematic review and meta-analyses of clinical studies. Miles PD, Treuner K, Latronica M, Olefsky JM, Barlow C. Impaired insulin secretion in a mouse model of ataxia telangiectasia.

Am J Physiol Endocrinol Metab. Volkow ND, et al. Brain glucose metabolism in adults with ataxia-telangiectasia and their asymptomatic relatives.

Brain : a journal of neurology. Article Google Scholar. Vail G, et al. ATM protein is located on presynaptic vesicles and its deficit leads to failures in synaptic plasticity. Journal of neurophysiology:jn. Genik PC, et al. Strain background determines lymphoma incidence in Atm knockout mice.

Ortinski PI, et al. Selective induction of astrocytic gliosis generates deficits in neuronal inhibition. Chen S, Wang G, Makrigiorgos GM, Price BD.

Stable siRNA-mediated silencing of ATM alters the transcriptional profile of HeLa cells. Biochem Biophys Res Commun. Rotman G, Shiloh Y.

ATM: a mediator of multiple responses to genotoxic stress. Nicklin P, et al. Bidirectional transport of amino acids regulates mTOR and autophagy. Shen C, Houghton PJ. The mTOR pathway negatively controls ATM by up-regulating miRNAs. Proc Natl Acad Sci U S A. Alexander A, et al. ATM signals to TSC2 in the cytoplasm to regulate mTORC1 in response to ROS.

Nuclear accumulation of HDAC4 in ATM deficiency promotes neurodegeneration in ataxia telangiectasia. Nat Med. Patterson SL, et al. Some forms of cAMP-mediated long-lasting potentiation are associated with release of BDNF and nuclear translocation of phospho-MAP kinase.

Sakata K, et al. Critical role of promoter IV-driven BDNF transcription in GABAergic transmission and synaptic plasticity in the prefrontal cortex. Lamb BT, et al. Hum Mol Genet. Herrup K, Li J, Chen J. The role of ATM and DNA damage in neurons: upstream and downstream connections.

DNA repair. Rozas NS, et al. Prolonging the survival of Tsc2 conditional knockout mice by glutamine supplementation. Hiltunen JK, et al. Mitochondrial fatty acid synthesis and respiration.

Biochim Biophys Acta. Valentin-Vega YA, et al. Mitochondrial dysfunction in ataxia-telangiectasia. Yang DQ, Halaby MJ, Li Y, Hibma JC, Burn P. Cytoplasmic ATM protein kinase: an emerging therapeutic target for diabetes, cancer and neuronal degeneration. Drug Discov Today.

Armata HL, et al. Mol Cell Biol. Clem BF, Chesney J. Molecular pathways: regulation of metabolism by RB. Clinical cancer research : an official journal of the American Association for Cancer Research. Billups D, Marx MC, Mela I, Billups B.

Inducible presynaptic glutamine transport supports glutamatergic transmission at the calyx of Held synapse.

Ruzzo EK, et al. Deficiency of asparagine synthetase causes congenital microcephaly and a progressive form of encephalopathy. Scholl-Burgi S, et al. Article PubMed Google Scholar. Ligthart-Melis GC, et al.

Glutamine is an important precursor for de novo synthesis of arginine in humans. Kan MJ, et al. Hwang SY, et al. Son J, et al. Glutamine supports pancreatic cancer growth through a KRAS-regulated metabolic pathway.

Wise DR, Thompson CB. Glutamine addiction: a new therapeutic target in cancer. Trends Biochem Sci. Parry-Billings M, et al. The effect of tumour bearing on skeletal muscle glutamine metabolism. The International journal of biochemistry. Yoshida S, Kaibara A, Ishibashi N, Shirouzu K.

Glutamine supplementation in cancer patients. Yang L, et al. Metabolic shifts toward glutamine regulate tumor growth, invasion and bioenergetics in ovarian cancer. Mol Syst Biol. Klimberg VS, et al. Glutamine suppresses PGE2 synthesis and breast cancer growth.

J Surg Res. Lim V, Korourian S, Todorova VK, Kaufmann Y, Klimberg VS. Glutamine prevents DMBA-induced squamous cell cancer. Oral Oncol. Rubio I, et al.

Oral glutamine reduces radiation morbidity in breast conservation surgery. JPEN J Parenter Enteral Nutr. Download references. The authors thank Dr. Ping Xie for her help with plotting survival cure and statistics, Ms Li Deng and Dr. Jay Tischfield for their support with real-time PCR.

This work is supported by grants from the BrightFocus Foundation A, from NIH 1R01NS and from the Hong Kong Research Grants Council HKSAR GRF JC and KH designed the study. YC, JC, LL carried out the blood glutamine, glucose, body weight and life span studies and involved in the data analysis.

JC, YC, HC and YZ did the neuronal culture experiments RT-PCR, western blot and immunostaining and participated in data analysis. GV and MP carried out LTP recording experiments and data analysis. JL and RH performed the expression studies and data analysis.

JC drafted the manuscript. JC, KH, HC, RH and MP participated in the revision of the manuscript. All authors read and approved the manuscript.

All animal procedures were approved by the Rutgers University Institutional Animal Care and Use Committee protocol 06— Department of Cell Biology and Neuroscience, Rutgers University, Allison Road, Piscataway, NJ, , USA.

Jianmin Chen, Yanping Chen, Graham Vail, Lauren Louie, Jiali Li, Ronald P. Hart, Mark R. Division of Life Science, The Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong. Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan, China.

You can also search for this author in PubMed Google Scholar. Correspondence to Jianmin Chen. Open Access This article is distributed under the terms of the Creative Commons Attribution 4. Reprints and permissions. Chen, J. et al. The impact of glutamine supplementation on the symptoms of ataxia-telangiectasia: a preclinical assessment.

Mol Neurodegeneration 11 , 60 Download citation. Received : 08 December Accepted : 06 August Published : 18 August Anyone you share the following link with will be able to read this content:. Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative. Skip to main content. Search all BMC articles Search. Download PDF. Research article Open access Published: 18 August The impact of glutamine supplementation on the symptoms of ataxia-telangiectasia: a preclinical assessment Jianmin Chen ORCID: orcid.

Hart 1 , Mark R. Background Glutamine Gln or Q is the most abundant free amino acid in the human blood stream. Methods A-T mouse models For our A-T model, we chose the Atm tm1Awb mutant allele [ 13 ] and the Atm tm1Bal mutant allele [ 14 ] from The Jackson Laboratories. Blood glucose and glutamine measurements About 0.

Western blots and immunocytochemistry For western blot analysis, cultured neurons were lysed in RIPA buffer Thermo Scientific containing proteinase and phosphatase inhibitors Roche Diagnostics. RT PCR and real-time PCR Total RNA was purified using TRIzol reagent Life Technologies following the standard protocol.

Primer sets used for real-time PCR include: For 36B4 control Forward: atcgtctttaaaccccgcgt Reverse: acgttgtctgctcccacaat; For mBDNF common region Forward: gaaggctgcaggggcatagacaaa Reverse: tacacaggaagtgtctatccttatg.

Primer sets used for RT-PCR were: BDNF exon2 Forward: ggaagtggaagaaaccgtctagagca Reverse: gaagtgtacaagtccgcgtcctta BDNF exon3 Forward: gctttctatcatccctccccgagagt Reverse: gaagtgtacaagtccgcgtcctta BDNF exon4 Forward: ctctgcctagatcaaatggagcttc Reverse: gaagtgtacaagtccgcgtcctta 36B4 Forward: atcgtctttaaaccccgcgt Reverse: acgttgtctgctcccacaat Field potential recording Extracellular recordings of field EPSPs fEPSPs were made with ACSF-filled glass electrodes 5—10 μm tip diameter according to protocols previously established in our lab [ 16 ].

Statistics For lifespan study, the significance of the difference between the glutamine and control curves was determined by the Mantel-Cox log-rank test.

Results Glutamine modulates the metabolomics of ATM deficiency Our previous research has shown that glutamine has a broad neuroprotective effect [ 1 ], so we became interested in whether glutamine deficiency contributed to the A-T phenotype.

A glutamine-revved brain supposedly becomes more alert, sharp-witted and also more erotically inclined; some practitioners prescribe glutamine for sexual dysfunction. Glutamine enthusiasts say it helps remove toxic metabolic residue from the brain, which further improves neural function.

But others caution that in some people, a serious excess of glutamine could overexcite or even damage brain cells. The low dosages included in these products pose very little potential danger, but they also provide very little benefit.

Depending on your training intensity, researchers recommend 8 to 20 grams of glutamine daily. Rather than taking glutamine by itself, try mixing the powder into a protein drink.

Because of a lack of research, most medical authorities also recommend avoiding glutamine supplements while pregnant or breastfeeding. Glutamine is generally considered safe and, when taken under the right circumstances, it can be very beneficial.

However, nature never exposes the brain to concentrated doses of a single amino acid, and the fact remains that many natural, healthy nutrients become toxic when consumed in unnaturally high amounts over extended time periods. To date, the long-term effects of taking large doses of any single amino acid that crosses the protective blood-brain barrier remain unknown.

So if you do have any concerns, a diet full of glutamine-rich foods is probably your safest bet. Your email address will not be published. And yet most of us have no idea how our mitochondria work.

But dietary fiber also performs other key roles that might surprise you, affecting everything from your skin to your gallbladder, heart and immunity. Join Members Experience Life Work Living Store More Sites. Life Time Athletic Events Life Time Foundation Life Time Academy Culture of Inclusion.

Life Time Member App. Join Members Work Living Newsletter Store Life Time Athletic Events Life Time Events Life Time Academy Culture of Inclusion Life Time Member App. The Health Benefits of Glutamine. This amino acid promises much — for mind, muscle and immunity.

Can taking glutamine really help you? By Daniel Larraya Experience Life November 1, Thoughts to share? Leave a Comment. Since taking other amino acids it has helped me, a year in May. But really want to see if L glutamine will help me even more.

I may end up with all three Glutamine, glycine and niacin b3. I recieved a L glutamine order today. I already take glycine. I take other amino acids for energy. I play pickleball 15 to 20 hours a week. Its helped a lot for energy and recovery.

Pauline, The recommended daily dosage of L-glutamine is 2 to 5 grams per day. Serious power athletes often dose up to 10 grams of L-glutamine per day. Try 1 — 2 grams to start with. Glutamine has a bad effect on me but I need it to fix my gene defect skeletal dysplasia.

However it turns into glutamate. Maybe a b6 deficiency was stopping it from converting into GABA? David, I am not a power athlete. I just play a lot where as felt I may need both benefits glutamine can give me. David, I starter taking L Glutamine after workout.

It helped with recovery and kept me energized. At first when I started taking it in very small dose, I thought it was just me feeling good.

Then by the 4th day I determined it was indeed the L Glutamine effect. Then I thought to try it in the morning.

So I took it early about 2 hours before I take my Essential Amino Acids. My EAA helps with energy for my Pickleball games. Amazingly this was my third day of taking it like this.

My focus was excellent and concentration helped me to remember the score so much better and the noise on our busy pickleball gym was not distracting. All I can say is WOW. I am amazed at how its working and aiding in my short attention span and memory.

In pickleball it can get a bit heated. So these last three days with the way I have been taking it have been fantastic. It doesnt seem there is any interference from taking L Glutamine then taking my EAA 2 hours later.

It seems to be working very well with me. Your email address will not be published. Save my name, email, and website in this browser for the next time I comment.

This site uses Akismet to reduce spam. Learn how your comment data is processed. Nootropics Guides Nootropic Stacks for Beginners Acetylcholine in Nootropic Stacks Choline in Nootropic Stacks Create the Best Nootropic Stack Best Pre-Made Nootropic Stacks Top 7 Nootropic Adaptogens to Conquer Anxiety and Stress.

Frequently Asked Questions Are Nootropics Addictive? Know the Risks What is the best vitamin for memory and focus? Are Nootropics Legal in My Country? How do Nootropics Work? How Long Does it Take for Omega-3 to Work?

Do I have low dopamine? Featured Posts The Benefits of Nootropic Supplements for Autism in The Benefits of Medicinal Nootropic Mushrooms Adderall Alternatives: Best Over the Counter Substitutes Top 7 Nootropic Adaptogens to Conquer Anxiety and Stress Sex Hormones and Your Brain Psychobiotics: The Gut-Brain Connection See All Featured Posts Donations.

Buyer's Guides Buying Tips The Best Nootropics of Tips for Choosing Nootropic Supplements What I Take Where to Buy Nootropics Vetting Nootropic Companies. Nootropics Compared Best Nootropics to Buy on Amazon Best MCT Oil Supplement to Buy Best Prebiotics to Buy Best Multivitamin for Men to Buy Best Multivitamin for Women to Buy The Top 7 Racetams — Which One is Best?

Nootropics List Amino Acids Etc 5-HTP Acetyl-L-Carnitine ALCAR GABA Glycine L-Carnosine L-DOPA L-Glutamine L-Theanine Melatonin N-Acetyl L-Cysteine NAC N-Acetyl L-Tyrosine Phenylalanine SAM-e Taurine Tryptophan Tyrosine.

Racetams Aniracetam Coluracetam Nefiracetam Oxiracetam Phenylpiracetam Piracetam Pramiracetam. Nootropics List Nootropics List. Author: David Tomen. Published: July 5, Table of Contents Toggle Overview How does L-Glutamine work in the Brain?

How things go bad L-Glutamine benefits How does L-Glutamine feel? L-Glutamine Clinical Research L-glutamine Increases Human Growth Hormone L-glutamine Improves Cerebral Performance L-Glutamine Nootropic Recommended Dosage L-Glutamine Side Effects Types of L-Glutamine to Buy Nootropics Expert Recommendation.

L-glutamine can help improve alertness, concentration, focus, memory and mood, boost Human Growth Hormone and reduce anxiety. Nootropics Expert Recommendation L-Glutamine 2 — 5 grams per day. L-glutamine also helps to curb the desire for sugar, carbs and alcohol. References [i] Chwals W.

source [ii] Newsholme P. source [iii] Petroff O. source [iv] Ramadan S. source [v] Albrecht J. source [vii] Sibson N. source [viii] De Witte P. source [ix] Lee Y. source [x] Lin M. source [xi] Zhou Y. source [xii] Boumezbeur F.

source [xiv] Mittendorfer B. source [xv] Welbourne T. source [xvi] Arwert L. Subscribe to the Nootropics Expert newsletter Keep up to date with the latest developments in the nootropics space.

Email address Subscribe. Latest Activity Recently Updated Posts Mind Lab Pro vs Modafinil: A Comprehensive Comparison for Cognitive Enhancement Choline Bitartrate Performance Lab Prebiotic Review Mind Lab Pro vs Genius Mindfulness: Unveiling the Best Nootropic Best Brain Supplements to Buy in Latest Comments David Tomen on L-DOPA David Tomen on Best Nootropics for Learning and Memory David Tomen on 13 Essential Vitamins Good for the Brain David Tomen on Huperzine-A patt on Huperzine-A.

Where to Buy Nootropics Wondering where to buy the best nootropic supplements? I also include a link to my full review for each supplement here […] Where to Buy Nootropics Read More. Nootropic Stack. The Definitive Guide to Nootropics Read More.

Quercetin for COVID The Most Comprehensive Nootropics List Read More. Book a personal consultation. Join The Discussion - comments Lianne November 21, Hi David, once again thank you for your brilliant work.

Thank you.

Thank you for funcrion nature. You finction using a browser version with cotnitive support for Glutakine. To obtain the best cognitve, we recommend you Glutamine and cognitive function a more up to date browser Glutamine and cognitive function turn off Injury prevention in the workplace mode in Internet Explorer. Coconut Oil Uses the meantime, to ensure continued support, we are displaying the site without styles and JavaScript. Substantial evidence implicates the nucleus accumbens in motivated performance, but very little is known about the neurochemical underpinnings of individual differences in motivation. Here, we applied 1 H magnetic resonance spectroscopy 1 H-MRS at ultra-high-field in the nucleus accumbens and inquired whether levels of glutamate Gluglutamine GlnGABA or their ratios predict interindividual differences in effort-based motivated task performance. Given the incentive value of social competition, we also examined differences in performance under self-motivated or competition settings.